rna.ps

%!PS-Adobe-3.0 EPSF-3.0
%%Creator: ViennaRNA-2.6.4
%%CreationDate: Mon Oct  9 18:27:19 2023
%%Title: RNA Secondary Structure Plot
%%BoundingBox: 0 0 700 700
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

% Program options: 

% To switch off outline pairs of sequence comment or
% delete the appropriate line near the end of the file

/RNAplot 100 dict def

RNAplot begin

%%BeginProlog

/fsize  14 def
/outlinecolor {0.2 setgray} bind def
/paircolor    {0.2 setgray} bind def
/seqcolor     {0   setgray} bind def
/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/arccoords { % i j arccoords
  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
  % onto the stack
  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
  4 -2 roll 5 -1 roll {exch} if 4 2 roll
  sequence length dup 2 div exch 3 1 roll lt 
  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
    exch add 4 -1 roll dup 5 1 roll sub 1 sub
    5 -1 roll not {4 -2 roll exch 4 2 roll} if
  }ifelse
   % compute the scalingfactor and prepare (1-sf) and sf*r
  2 mul exch cpr 3 1 roll div dup
  3 -1 roll mul exch 1 exch sub exch
   % compute the coordinates
  3 -1 roll 1 sub coor exch get aload pop % get coord for i
  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
  5 -1 roll 1 sub coor exch get aload pop % get coord for j
  % duplicate j coord
  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
  6 -1 roll mul 5 -1 roll add exch % calculate x2
  6 -2 roll % reorder
} bind def
/drawoutline {
  gsave outlinecolor newpath
  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
  currentdict /cutpoint known        % check if cutpoint is defined
  {coor 0 cutpoint getinterval
   {aload pop lineto} forall         % draw outline of 1st sequence
   coor cutpoint 1 add get aload pop
   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
   {aload pop lineto} forall        % draw outline of 2nd sequence
     } {
        /i 0 def
        coor {
            /p coor i get def
            /a arcs i get def
            /l a length def
            l 0 eq {
                %% standard point... draw simple line
                p 0 2 getinterval aload pop lineto
            } {
                %% point in loop... draw arc around loop center
                /clockwise a 5 get def
                clockwise 0.0000000 gt {
                    a 0 5 getinterval aload pop arcn
                } {
                    a 0 5 getinterval aload pop arc
                } ifelse
            } ifelse
            /i i 1 add def
        } forall
    }
  ifelse
  stroke grestore
} bind def
/drawpairs {
  paircolor
  0.7 setlinewidth
  [9 3.01] 9 setdash
  newpath
  pairs {aload pop
      currentdict (cpr) known
      { exch dup
        coor  exch 1 sub get aload pop moveto
        exch arccoords curveto
      }
      { coor exch 1 sub get aload pop moveto
        coor exch 1 sub get aload pop lineto
      }ifelse
  } forall
  stroke
} bind def
% draw bases
/drawbases {
  [] 0 setdash
  seqcolor
  0
  coor {
    aload pop moveto
    dup sequence exch 1 getinterval cshow
    1 add
  } forall
  pop
} bind def
/init {
  /Helvetica findfont fsize scalefont setfont
  1 setlinejoin
  1 setlinecap
  0.8 setlinewidth
  % find the coordinate range
  /xmax -1000 def /xmin 10000 def
  /ymax -1000 def /ymin 10000 def
  coor {
      aload pop
      dup ymin lt {dup /ymin exch def} if
      dup ymax gt {/ymax exch def} {pop} ifelse
      dup xmin lt {dup /xmin exch def} if
      dup xmax gt {/xmax exch def} {pop} ifelse
  } forall
  /size {xmax xmin sub ymax ymin sub max} bind def
  /width {xmax xmin sub} bind def
  /height {ymax ymin sub} bind def
  10 10 translate
  680 size 10 add div dup scale
  size width sub width xmin sub xmax sub add 2 div 5 add
  size height sub height ymin sub ymax sub add 2 div 5 add
  translate
} bind def

%%EndProlog

% data start here
/sequence { (\
AUGCGUACGAUCGAUCGAUCGAUAUGCGUACGAUCGAUCGAUCGAUAUGCGUACGAUCGAUCGAUCGAUAUGCGUACGAUCGAUCGAUCGAU\
) } def
/len { sequence length } bind def

/coor [
[78.42173767 351.43972778]
[64.02448273 356.78900146]
[48.88415146 354.20715332]
[37.07341385 344.38870239]
[31.76929855 329.97476196]
[34.39858627 314.84259033]
[44.25401306 303.06268311]
[58.68451691 297.80377197]
[61.20603180 283.01724243]
[63.72754288 268.23068237]
[66.24906158 253.44415283]
[68.77056885 238.65759277]
[71.29208374 223.87104797]
[73.81359863 209.08450317]
[76.33511353 194.29795837]
[78.85662842 179.51141357]
[81.37813568 164.72486877]
[83.89965057 149.93832397]
[86.42116547 135.15176392]
[88.94268036 120.36522675]
[91.46419525 105.57867432]
[89.58316803 97.55493927]
[94.32868195 90.33885956]
[97.34815979 75.64591217]
[100.36763763 60.95296478]
[103.38711548 46.26001358]
[106.40659332 31.56706429]
[109.42607117 16.87411499]
[112.44554901 2.18116641]
[115.46502686 -12.51178265]
[118.23591614 -27.25363350]
[120.75743103 -42.04018021]
[123.27894592 -56.82672882]
[125.80045319 -71.61327362]
[128.32197571 -86.39981842]
[130.84349060 -101.18637085]
[133.36499023 -115.97291565]
[135.88650513 -130.75946045]
[138.40802002 -145.54600525]
[140.92953491 -160.33255005]
[143.45104980 -175.11911011]
[145.97256470 -189.90565491]
[148.49407959 -204.69219971]
[151.01559448 -219.47874451]
[139.55493164 -229.80622864]
[135.51911926 -244.69635010]
[140.19596863 -259.39773560]
[152.09312439 -269.21920776]
[167.41421509 -271.02679443]
[181.27037048 -264.24368286]
[189.24012756 -251.03434753]
[188.78036499 -235.61384583]
[180.03779602 -222.90278625]
[165.80213928 -216.95722961]
[163.28062439 -202.17068481]
[160.75910950 -187.38414001]
[158.23759460 -172.59759521]
[155.71607971 -157.81103516]
[153.19456482 -143.02449036]
[150.67304993 -128.23794556]
[148.15155029 -113.45140076]
[145.63003540 -98.66485596]
[143.10852051 -83.87831116]
[140.58700562 -69.09175873]
[138.06549072 -54.30521393]
[135.54397583 -39.51866531]
[133.02246094 -24.73212051]
[135.04315186 -17.46032906]
[130.15797424 -9.49230480]
[127.13849640 5.20064402]
[124.11901855 19.89359283]
[121.09954071 34.58654404]
[118.08006287 49.27949142]
[115.06058502 63.97243881]
[112.04110718 78.66539001]
[109.02162933 93.35833740]
[106.25074005 108.10018921]
[103.72922516 122.88673401]
[101.20771027 137.67327881]
[98.68619537 152.45982361]
[96.16468811 167.24638367]
[93.64317322 182.03292847]
[91.12165833 196.81947327]
[88.60014343 211.60601807]
[86.07862854 226.39256287]
[83.55712128 241.17910767]
[81.03560638 255.96565247]
[78.51409149 270.75219727]
[75.99257660 285.53875732]
[73.47106171 300.32528687]
[85.34312439 310.06951904]
[90.73749542 324.44992065]
] def
/arcs [
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
[]
] def
/pairs [
[8 90]
[9 89]
[10 88]
[11 87]
[12 86]
[13 85]
[14 84]
[15 83]
[16 82]
[17 81]
[18 80]
[19 79]
[20 78]
[21 77]
[23 76]
[24 75]
[25 74]
[26 73]
[27 72]
[28 71]
[29 70]
[30 69]
[31 67]
[32 66]
[33 65]
[34 64]
[35 63]
[36 62]
[37 61]
[38 60]
[39 59]
[40 58]
[41 57]
[42 56]
[43 55]
[44 54]
] def

init

% switch off outline pairs or bases by removing these lines
drawoutline
drawpairs
drawbases
showpage
end
%%EOF