Skip to content

Example 4

Jump to bottom
Kinggerm edited this page Apr 6, 2021 · 14 revisions

Here we will demonstrate the animal mitogenome assembly using a public real dataset, SRR5201683. It's a WGS dataset of Myodes glareolus, a rodent species.

Let's download 50M bases of reads from Genbank. You have to install sra-tools (https://github.com/ncbi/sra-tools) before you use fastq-dump.

fastq-dump --origfmt --split-files -X 250000 --gzip SRR5201683

Alternatively, you can download a reduced dataset from GetOrganelleGallery using wget:

wget https://github.com/Kinggerm/GetOrganelleGallery/blob/master/Test/reads/SRR5201683_1.fastq.gz
wget https://github.com/Kinggerm/GetOrganelleGallery/blob/master/Test/reads/SRR5201683_2.fastq.gz
# use gitlab if above links fail, e.g. https://gitlab.com/Kinggerm/GetOrganelleGallery/-/raw/master/Test/reads/SRR5201683_1.fastq.gz

# then check the integrity of downloaded file using md5sum:
md5sum SRR5201683*.fastq.gz
# 287765e5ef6131f15aaabd2eb227485d  SRR5201683_1.fastq.gz
# e45bf7f244ce59da9d79b206ca08ff6b  SRR5201683_2.fastq.gz
# Please re-download the reads if md5 values unmatched

Run

Then, conduct the assembly (Memory: ~0.3G; Duration: ~70 sec):

get_organelle_from_reads.py -1 SRR5201683_1.fastq.gz -2 SRR5201683_2.fastq.gz -F animal_mt -o SRR5201683-mitogenome -R 10

Output

It should finish with main output files in the output directory SRR5201683-mitogenome:

  • get_org.log.txt      the log file, click to expand

    GetOrganelle v1.7.0-beta5 # file names changed according to 1.7.4-pre

    get_organelle_from_reads.py assembles organelle genomes from genome skimming data.
    Find updates in https://github.com/Kinggerm/GetOrganelle and see README.md for more information.

    Python 3.6.10 |Anaconda, Inc.| (default, Mar 25 2020, 23:51:54) [GCC 7.3.0]
    PYTHON LIBS: numpy 1.18.1; sympy 1.5.1; scipy 1.4.1; psutil 5.7.0
    DEPENDENCIES: Bowtie2 2.3.5.1; SPAdes 3.12.0; Blast 2.9.0; Bandage 0.8.1
    SEED DB: animal_mt 0.0.0
    LABEL DB: animal_mt 0.0.0
    WORKING DIR: /home/data1
    /root/.pyenv/versions/miniconda3-4.3.30/bin/get_organelle_from_reads.py -1 SRR5201683_1.fastq.gz -2 SRR5201683_2.fastq.gz -F animal_mt -o SRR5201683-mitogenome -R 10

    2020-06-06 05:50:25,836 - INFO: Pre-reading fastq ...
    2020-06-06 05:50:25,836 - INFO: Estimating reads to use ... (to use all reads, set '--reduce-reads-for-coverage inf')
    2020-06-06 05:50:26,634 - INFO: Estimating reads to use finished.
    2020-06-06 05:50:26,635 - INFO: Unzipping reads file: SRR5201683_1.fastq.gz (21139461 bytes)
    2020-06-06 05:50:27,028 - INFO: Unzipping reads file: SRR5201683_2.fastq.gz (22879815 bytes)
    2020-06-06 05:50:27,433 - INFO: Counting read qualities ...
    2020-06-06 05:50:27,518 - INFO: Identified quality encoding format = Illumina 1.8+
    2020-06-06 05:50:27,519 - INFO: Trimming bases with qualities (0.00%): 33..33 !
    2020-06-06 05:50:27,572 - INFO: Mean error rate = 0.0253
    2020-06-06 05:50:27,574 - INFO: Counting read lengths ...
    2020-06-06 05:50:28,057 - INFO: Mean = 98.8 bp, maximum = 99 bp.
    2020-06-06 05:50:28,058 - INFO: Reads used = 250000+250000
    2020-06-06 05:50:28,058 - INFO: Pre-reading fastq finished.

    2020-06-06 05:50:28,058 - INFO: Making seed reads ...
    2020-06-06 05:50:28,058 - INFO: Seed bowtie2 index existed!
    2020-06-06 05:50:28,058 - INFO: Mapping reads to seed bowtie2 index ...
    2020-06-06 05:50:39,885 - INFO: Mapping finished.
    2020-06-06 05:50:39,885 - INFO: Seed reads made: SRR5201683-mitogenome/seed/animal_mt.initial.fq (2393450 bytes)
    2020-06-06 05:50:39,885 - INFO: Making seed reads finished.

    2020-06-06 05:50:39,886 - INFO: Checking seed reads and parameters ...
    2020-06-06 05:50:39,886 - INFO: The automatically-estimated parameter(s) do not ensure the best choice(s).
    2020-06-06 05:50:39,886 - INFO: If the result graph is not a circular organelle genome,
    2020-06-06 05:50:39,886 - INFO: you could adjust the value(s) of '-w'/'-R' for another new run.
    2020-06-06 05:50:42,211 - INFO: Pre-assembling mapped reads ...
    2020-06-06 05:50:44,406 - INFO: Pre-assembling mapped reads finished.
    2020-06-06 05:50:44,406 - INFO: Estimated animal_mt-hitting base-coverage = 172.60
    2020-06-06 05:50:44,406 - INFO: Estimated word size(s): 48
    2020-06-06 05:50:44,406 - INFO: Setting '-w 48'
    2020-06-06 05:50:44,407 - INFO: Setting '--max-extending-len inf'
    2020-06-06 05:50:44,481 - INFO: Checking seed reads and parameters finished.

    2020-06-06 05:50:44,481 - INFO: Making read index ...
    2020-06-06 05:50:47,942 - INFO: Mem 0.285 G, 435735 candidates in all 500000 reads
    2020-06-06 05:50:47,943 - INFO: Pre-grouping reads ...
    2020-06-06 05:50:47,943 - INFO: Setting '--pre-w 48'
    2020-06-06 05:50:47,972 - INFO: Mem 0.265 G, 8522/8522 used/duplicated
    2020-06-06 05:50:48,392 - INFO: Mem 0.266 G, 18 groups made.
    2020-06-06 05:50:48,425 - INFO: Making read index finished.

    2020-06-06 05:50:48,426 - INFO: Extending ...
    2020-06-06 05:50:48,426 - INFO: Adding initial words ...
    2020-06-06 05:50:48,570 - INFO: AW 61646
    2020-06-06 05:50:50,446 - INFO: Round 1: 435735/435735 AI 23645 AW 295782 Mem 0.158
    2020-06-06 05:50:52,138 - INFO: Round 2: 435735/435735 AI 24282 AW 319640 Mem 0.161
    2020-06-06 05:50:54,009 - INFO: Round 3: 435735/435735 AI 24633 AW 332724 Mem 0.162
    2020-06-06 05:50:55,776 - INFO: Round 4: 435735/435735 AI 25081 AW 347414 Mem 0.164
    2020-06-06 05:50:57,793 - INFO: Round 5: 435735/435735 AI 25614 AW 363798 Mem 0.181
    2020-06-06 05:50:59,829 - INFO: Round 6: 435735/435735 AI 26098 AW 378706 Mem 0.183
    2020-06-06 05:51:01,901 - INFO: Round 7: 435735/435735 AI 26397 AW 389078 Mem 0.184
    2020-06-06 05:51:03,939 - INFO: Round 8: 435735/435735 AI 26803 AW 402408 Mem 0.185
    2020-06-06 05:51:05,980 - INFO: Round 9: 435735/435735 AI 27173 AW 414670 Mem 0.186
    2020-06-06 05:51:08,035 - INFO: Round 10: 435735/435735 AI 27773 AW 433016 Mem 0.188
    2020-06-06 05:51:08,035 - INFO: Hit the round limit 10 and terminated ...
    2020-06-06 05:51:08,729 - INFO: Extending finished.

    2020-06-06 05:51:08,742 - INFO: Separating extended fastq file ...
    2020-06-06 05:51:08,941 - INFO: Setting '-k 21,55,85'
    2020-06-06 05:51:08,941 - INFO: Assembling using SPAdes ...
    2020-06-06 05:51:08,947 - INFO: spades.py -t 1 -1 SRR5201683-mitogenome/extended_1_paired.fq -2 SRR5201683-mitogenome/extended_2_paired.fq --s1 SRR5201683-mitogenome/extended_1_unpaired.fq --s2 SRR5201683-mitogenome/extended_2_unpaired.fq -k 21,55,85 -o SRR5201683-mitogenome/extended_spades
    2020-06-06 05:51:31,237 - INFO: Insert size = 246.309, deviation = 82.1998, left quantile = 156, right quantile = 355
    2020-06-06 05:51:31,237 - INFO: Assembling finished.

    2020-06-06 05:51:32,470 - INFO: Slimming SRR5201683-mitogenome/extended_spades/K85/assembly_graph.fastg finished!
    2020-06-06 05:51:33,660 - INFO: Slimming SRR5201683-mitogenome/extended_spades/K55/assembly_graph.fastg finished!
    2020-06-06 05:51:33,660 - INFO: Slimming assembly graphs finished.

    2020-06-06 05:51:33,661 - INFO: Extracting animal_mt from the assemblies ...
    2020-06-06 05:51:33,662 - INFO: Disentangling SRR5201683-mitogenome/extended_spades/K85/assembly_graph.fastg.extend-animal_mt.fastg as a circular genome ...
    2020-06-06 05:51:33,668 - INFO: Average animal_mt kmer-coverage = 67.5
    2020-06-06 05:51:33,668 - INFO: Average animal_mt base-coverage = 450.6
    2020-06-06 05:51:33,668 - INFO: Writing output ...
    2020-06-06 05:51:33,676 - INFO: Writing PATH1 of complete animal_mt to SRR5201683-mitogenome/animal_mt.K85.complete.graph1.1.path_sequence.fasta
    2020-06-06 05:51:33,676 - INFO: Writing GRAPH to SRR5201683-mitogenome/animal_mt.K85.complete.graph1.selected_graph.gfa
    2020-06-06 05:51:33,761 - INFO: Writing GRAPH image to SRR5201683-mitogenome/animal_mt.K85.complete.graph1.selected_graph.png
    2020-06-06 05:51:33,762 - INFO: Result status of animal_mt: circular genome
    2020-06-06 05:51:33,777 - INFO: Please check the produced assembly image or manually visualize SRR5201683-mitogenome/extended_K85.assembly_graph.fastg.extend-animal_mt.fastg using Bandage to confirm the final result.
    2020-06-06 05:51:33,777 - INFO: Writing output finished.
    2020-06-06 05:51:33,778 - INFO: Extracting animal_mt from the assemblies finished.


    Total cost 68.45 s
    Thank you!

  • extended_K85.assembly_graph.fastg     

  • extended_K85.assembly_graph.fastg.extend-animal_mt.fastg     

  • extended_K85.assembly_graph.fastg.extend-animal_mt.csv     

    EDGE	database	loci	loci_gene_sequential	loci_sequential	details
33956	animal_mt	atp6,cox1,cox2,cox3,cytb,nad1,nad4,nad5,rrnL,rrnS	nad1>>rrnL>>rrnS>>cytb>>nad5>>nad4>>cox3>>atp6>>cox2>>cox1>>33956	nad1>>rrnL>>rrnS>>cytb>>nad5>>nad4>>cox3>>atp6>>cox2>>cox1>>33956	nad1(1517-2442,animal_mt)>>rrnL(2547-4118,animal_mt)>>rrnS(4190-5136,animal_mt)>>cytb(6305-7431,animal_mt)>>nad5(8238-9676,animal_mt)>>nad4(10043-11278,animal_mt)>>cox3(12191-12975,animal_mt)>>atp6(12975-13655,animal_mt)>>cox2(13881-14567,animal_mt)>>cox1(14695-16259,animal_mt)>>33956

    note that the loci information is based on blast-hit rather than thorough annotation.

  • animal_mt.K85.complete.graph1.1.path_sequence.fasta      assembled mitogenome sequence

    >33956+(circular)
TGTTTAGCTGTTAACTAAAAATTTATAGGTTTGAGTCCTATCAATCTAG .. (16,353 bp)

  • animal_mt.K85.complete.graph1.selected_graph.gfa      assembly graph

    S	33956	CGAAGGTGTAGAGAACTGATTCTACTAAGGCTTCTCCCGCCCCCT .. (16,438 bp, including an 85-bp overlap)
L	33956	-	33956	-	85M
  • animal_mt.K85.complete.graph1.selected_graph.png     

    This file will be generated when Bandage was added to the $PATH (optional). Bandage-visualized

Besides, you will find lots of temporary files that you can delete them after a successful assembly:
  • seed      subfolder of seed reads and parameter estimation temp files
    • animal_mt.initial.sam      mapping alignment
    • animal_mt.initial.fq      seed reads used for read extending
    • animal_mt.initial.fq.spades      used for parameter estimation, draft assembly
  • extended_1_paired.fq      target organelle associated reads - paired forward
  • extended_1_unpaired.fq      target organelle associated reads - unpaired forward
  • extended_2_paired.fq      target organelle associated reads - paired reverse
  • extended_2_unpaired.fq      target organelle associated reads - unpaired reverse
  • extended_spades      subfolder of SPAdes assemblies
    • scaffolds.paths
    • assembly_graph_with_scaffolds.gfa
    • assembly_graph.fastg
    • spades.log**
    • K85
      • assembly_graph.fastg.extend-animal_mt.fastg
      • assembly_graph.fastg.extend-animal_mt.csv
      • (other files)
    • K55
      • assembly_graph.fastg.extend-animal_mt.fastg
      • assembly_graph.fastg.extend-animal_mt.csv
      • (other files)
    • (other files)      K21, input_dataset.yaml, contigs.fasta, scaffolds.fasta, etc.

Home

Installation

Initialization

Examples

Usage

FAQ

Clone this wiki locally